Skip Navigation
Skip to contents

Perspect Integr Med : Perspectives on Integrative Medicine

OPEN ACCESS
SEARCH
Search

Articles

Page Path
HOME > Perspect Integr Med > Volume 4(2); 2025 > Article
Original Article
Apamin Mitigates Oxidative Stress-Induced Nucleus Pulposus Cell Death Through Regulation of Nrf2 and HO-1 Pathways
Hyunseong Kim1orcid, Hwan-Suck Chung2orcid, Hyunsu Bae1,*orcid
Perspectives on Integrative Medicine 2025;4(2):96-102.
DOI: https://doi.org/10.56986/pim.2025.06.004
Published online: June 30, 2025

1Department of Physiology, College of Korean Medicine, Kyung Hee University, Seoul, Republic of Korea

2Korean Medicine Application Center, Korea Institute of Oriental Medicine, Daegu, Republic of Korea

*Corresponding author: Hyunsu Bae, Department of Physiology, College of Korean Medicine, Kyung Hee University, 26 Kyungheedae-ro, Dongdaemun-gu, Seoul 02447, Republic of Korea, Email: hbae@khu.ac.kr
• Received: November 6, 2024   • Revised: May 12, 2025   • Accepted: May 28, 2025

©2025 Jaseng Medical Foundation

This is an open access article under the CC BY-NC license (http://creativecommons.org/licenses/by-nc/4.0/).

prev next
  • 2,436 Views
  • 34 Download
  • 1 Crossref
  • Background
    Intervertebral disc degeneration is driven by the decline of nucleus pulposus (NP) cells and oxidative stress plays a key role in extracellular matrix disruption and progression of the condition. Apamin, a bioactive peptide derived from bee venom is neuroprotective and anti-inflammatory, but its effect on NP cells under oxidative stress is unknown.
  • Methods
    Human NP cells were cultured, pretreated with apamin, and exposed to 200 μM H2O2 (causing oxidative stress). Reactive oxygen species (ROS) levels, disc degeneration markers, and the regulation of nuclear factor erythroid 2-related factor 2 (Nrf2) and heme oxygenase 1 (HO-1) signaling pathways were assessed using immunocytochemistry and fluorescence-activated cell sorting analysis.
  • Results
    Apamin protected NP cell viability under oxidative stress at the optimal concentrations between 10–50 μg/mL. As a percentage relative to untreated control, apamin significantly inhibited the production of ROS (induced by H2O2) and the expression of Nrf2 and HO-1 (key regulators of the antioxidant response) was higher relative to the control. The expression of aggrecan and collagen Type 2 alpha 1 (essential components of the extracellular matrix) was higher relative to the control, while the expression of disc degeneration-related markers, including matrix metalloproteinases (MMPs) and a disintegrin and metalloproteinase with thrombospondin motifs (ADAMTS) was lower compared with the control.
  • Conclusion
    In vitro, apamin protects human NP cells from oxidative stress-induced death by inhibiting levels of ROS and activating the Nrf2 and HO-1 pathways. These results suggest potential for apamin as a therapeutic antioxidant agent for intervertebral disc degeneration.
Intervertebral disc degeneration (IDD) is a leading contributor to chronic back pain, affects a large number of individuals globally, and imposes a substantial socioeconomic impact [1,2]. At the core of IDD pathology is the degeneration of the nucleus pulposus (NP). The NP is a gellike core within the intervertebral disc which is essential for the maintenance of disc structure and biomechanical function through the production of extracellular matrix (ECM) components, including aggrecan and Type 2 collagen alpha 1 (COL2A1) [3,4].
While the precise cause underlying NP degradation remains unclear, it is established that during the progression of IDD, NP cells undergo significant changes driven by various factors, including mechanical overload, inflammatory cytokines, and oxidative stress [5]. Among these, oxidative stress plays a pivotal role. It results from an imbalance between the generation of reactive oxygen species (ROS) and the cellular antioxidant defense systems that neutralize them or repair associated damage caused [6,7]. Elevated ROS levels contribute to the deterioration of the disc microenvironment by promoting ECM breakdown, induction of NP cell apoptosis, and acceleration of overall disc degeneration [8]. As the number of NP cells is progressively reduced, disc height diminishes, mechanical properties are compromised, and this manifests the clinical features of IDD [9]. Oxidative stress amplifies these effects when ROS levels in NP cells increase, this activates catabolic enzymes such as matrix metalloproteinases (MMPs) and aggrecanases like A Disintegrin, and Metalloproteinase with Thrombospondin motifs (ADAMTS)-4, resulting in ECM degradation [10,11]. Given the central role of oxidative stress in driving both cellular loss and ECM breakdown [12], modulating oxidative stress pathways present a promising strategy for therapeutic intervention in IDD.
Apamin (APM), a bioactive peptide derived from bee venom, has gained attention for its neuroprotective, anti-inflammatory, and antioxidant properties [1316]. It has been shown to mitigate oxidative stress by restoring hepatic glutathione levels and upregulating antioxidant enzymes in acetaminophen-induced hepatotoxicity in a murine model [17]. As the 3rd largest peptide component in bee venom, APM is less toxic than melittin, and phospholipase A2 [14]. This underscores its potential applicability in therapeutic settings, notably in the context of neurological disorders.
In this study, we investigated the potential protective effects of APM on NP cells under oxidative stress conditions. We hypothesized that APM could reduce oxidative damage in NP cells through the upregulation of the nuclear factor erythroid 2-related factor (Nrf2) and heme oxygenase-1 (HO-1) regulatory pathway, thereby lowering ROS levels and preserving ECM integrity. Nrf2, a multifunctional regulator, is known for its cytoprotective role, regulation of genes involved in antioxidant, anti-inflammatory, and detoxifying processes, while also preventing oxidative stress-induced apoptosis [18,19]. Nrf2 activity is controlled by genes such as HO-1, which not only detoxifies heme but also produces protective molecules like biliverdin and carbon monoxide [20,21]. The Nrf2/HO-1 pathway is essential in the mitigation of oxidative stress and inhibition of cell apoptosis [22,23]. Additionally, we explored whether APM could influence the expression of key disc degeneration markers, such as MMP3 and ADAMTS-4. Understanding how APM protects NP cells from oxidative stress may offer valuable insights into new therapeutic strategies for treating IDD.
1. Human NP cell culture
Human NP cells [ScienCell Research Laboratories (SCRL; Carlsbad, California, USA)] were cultured in NP cell-specific medium (SCRL) containing 2% fetal bovine serum, 1% NP cell growth supplement, and 1% penicillin-streptomycin. Cultures were incubated at 37°C in a humidified atmosphere containing 5% CO2. Subculturing was performed at 2-day intervals. Cells were rinsed twice with prewarmed phosphate-buffered saline (PBS) and subsequently detached with 0.05% trypsin solution.
2. Sequential treatment of NP cells with APM and H2O2
NP cells were exposed to APM 30 minutes prior to 200 μM H2O2 (Sigma-Aldrich, St. Louis, MO, USA) treatment to induce oxidative stress. Cells were incubated for 24 hours after which analysis was conducted.
3. Human NP cell viability assay
To evaluate the effect of APM on human NP cell survival, cells were exposed to increasing concentrations of APM (1, 10, 25, 50, and 100 μg/mL), and incubated either alone or in combination with 200 μM H2O2 for 24 hours. Cell viability was assessed using the Cell Counting Kit-8 (CCK-8, Dojindo, Kumamoto, Japan), and absorbance was measured at 450 nm with a microplate reader (BioTek, Winooski, VT, USA).
4. Flow cytometry
Intracellular ROS generation was quantified to assess oxidative stress and the potential antioxidant activity of APM. To detect ROS, following cell detachment, NP cells were incubated with the fluorogenic probe 2′,7′-dichlorofluorescin diacetate, for 20 minutes at 37°C in a CO2-enriched environment. Cells were then washed and fixed using a commercial fixation buffer (BD Biosciences, Franklin Lakes, NJ, USA) for 10 minutes. Fluorescence activity was measured using an Accuri C6 Plus flow cytometer (BD Biosciences), and data were expressed as a percentage relative to untreated controls.
5. Immunohistochemistry
NP cells were permeabilized with 0.2% Triton X-100 in PBS for 5 minutes and then blocked with 10% normal goat serum for 1 hour. Cells were incubated overnight at 4°C with primary antibodies against: aggrecan (1:100; Proteintech, IL, USA), COL2A1 (1:100; Invitrogen, Waltham, MA, USA), MMP3 (1:50; Abcam, Cambridge, UK), MMP13 (1:100; Abcam), ADAMTS-4 (1:100; Abcam), ADAMTS-5 (1:100; Invitrogen), Nrf2 (1:200; Abcam), and HO-1 (1:200; Enzo Biochem, NY, USA). The cells were washed with PBS for 5 minutes, 3 times, and then the cells were treated with a secondary antibody (1:300; Jackson ImmunoResearch, West Grove, PA, USA) for 2 hours at 25 ± 1°C, followed by 3, 5-minute PBS washes. Nuclear staining of the cells with 4′,6-diamidino-2-phenylindole (DAPI; TCI, Tokyo, Japan) was performed, after which the cells were mounted on a slide with a mounting solution (Dako, Glostrup, DK). The stained cell imaging was performed using a confocal microscope (Eclipse C2 Plus, Nikon, Tokyo, Japan) at ×100 magnification.
6. Real-time polymerase chain reaction
Total ribonucleic acid was extracted from the NP cells using Trizol reagent (Thermo Fisher Scientific). Complementary deoxyribonucleic acid was synthesized using oligo deoxythymidine primers and AccuPower RT PreMix (Bioneer, Daejeon, Korea). Quantitative real-time polymerase chain reaction was conducted in triplicate using iQ SYBR Green Supermix on CFX Connect real-time polymerase chain reaction detection system (Bio-Rad, Hercules, CA, USA). Gene sequences used for amplification are listed in Table 1. Target gene expression levels were normalized to β-actin expression and presented as fold change relative to the untreated control group.
7. Statistical analysis
Results were expressed as mean ± standard error of the mean. Statistical significance was assessed via one-way or 2-way analysis of variance with Tukey’s post hoc test using GraphPad Prism 8.0 (GraphPad, Inc., La Jolla, CA, USA). A p < 0.05 was considered significant. Significance indicators: #p < 0.05, ##p < 0.01, ###p < 0.001, and ####p < 0.0001 vs. blank group, and *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001 vs. the untreated control group.
1. APM protects cell viability and suppressed ROS accumulation in oxidatively stressed NP cells
NP cells were treated with various concentrations of APM (0.1, 1, 5, 10, 25, 50, and 100 μg/mL) for 24 hours. APM concentrations between 10 and 50 μg/mL led to a significantly higher cell viability, compared with the remaining concentrations of APM, which demonstrated no statistically significant difference with the blank (Figure 1A). Under oxidative stress, induced by 200 μM H2O2, APM pretreatment protected viability in a dose-dependent manner starting from 5 μg/mL to 50 μg/mL (Figure 1B). Based on these findings, 10 and 50 μg/mL APM were selected for subsequent experiments. Notably, using 2′,7′-dichlorofluorescin diacetate staining, APM pretreatment (10 and 50 μg/mL) led to a significantly lower level of H2O2-induced ROS production in NP cells compared with the control (Figures 1C and 1D).
2. APM preserved ECM components in NP cells under oxidative stress
Immunostaining of ECM molecules indicated that H2O2 exposure diminished aggrecan and COL2A1 expression. APM pretreatment, prior to H2O2 exposure, led to a higher level of aggrecan and COL2A1 expression, which was observed in a concentration-dependent manner compared with the control (Figures 2A–2D). These findings suggest that APM protects NP cells from oxidative stress by mitigating the degradation of critical ECM components.
3. APM mitigated H2O2-induced ECM degradation by inhibiting MMPs and ADAMTS in NP cells
H2O2-treated NP cells exhibited marked upregulation of matrix-degrading enzymes including MMP3 and MMP13. However, pretreatment with APM at concentrations of 10 and 50 μg/mL substantially reduced their expression, compared with the control, in a dose-dependent manner (Figures 3A, 3B, 3E, and 3F). In the investigation of the effect of APM on ADAMTS enzymes in NP cells, which are the key mediators of ECM degradation, H2O2 exposure significantly upregulated the expression of these enzymes, further contributing to ECM breakdown. However, APM pretreatment at 10 and 50 μg/mL resulted in significantly lower expression, as compared with the untreated control, of both ADAMTS-4 and ADAMTS-5 in a dose-dependent manner (Figures 3C, 3D, 3G, and 3H). These results implied effective suppression of the oxidative stress-induced upregulation of ADAMTS enzymes by APM, supporting its protective role in maintaining ECM integrity and slowing disc degeneration.
4. APM activated the Nrf2/HO-1 pathway to enhance antioxidant defense in NP cells from oxidative damage
To further elucidate the molecular mechanisms of APM’s antioxidant effects, protein, and messenger ribonucleic acid levels of Nrf2 and HO-1 pathway were examined. Immunocytochemistry revealed that H2O2 treatment significantly reduced Nrf2 and HO-1 expression, compared with the blank group, indicating a disruption of the antioxidant defense system, but APM pretreatment at 10 and 50 μg/mL markedly protected both expressions at the protein (Figures 4A–4C) and transcript levels (Figures 4D and 4E), supporting activation of the Nrf2 and HO-1antioxidant response.
APM, a component of bee venom, exerts significant protective effects on NP cells under oxidative stress by protecting cell viability, preserving ECM integrity, inhibiting matrix-degrading enzymes, and activating the Nrf2/HO-1 antioxidant pathway. Despite traditionally being regarded as a neurotoxic peptide in bee venom, these findings align with previous reports suggesting that APM possesses neuroprotective and anti-inflammatory properties [1317]. The neuroprotective roles of APM, particularly in the context of central nervous system diseases, have garnered significant attention. APM regulates synaptic plasticity, learning, and memory by selectively inhibiting small-conductance calcium-activated potassium channels, which are present in various neuronal populations, including midbrain dopaminergic neurons [13,14,16]. This current study extends the understanding of APM’s protective effects on intervertebral disc cells, where it mitigates oxidative stress-induced damage. This broadens the potential applications of APM beyond neuroprotection, highlighting its role in cellular defense against oxidative stress across different tissue types. Our findings demonstrated that APM had a significantly higher level of Nrf2 and HO-1 expression, as compared with the control, which is relevant because Nrf2 and HO-1 are key regulators of cellular antioxidant defenses. APM’s neuroprotective effects have also been attributed to this mechanism, where it reduces oxidative damage by upregulating antioxidant enzymes. In NP cells, APM pretreatment inhibited H2O2 -induced downregulation of Nrf2 and HO-1, suggesting that APM enhanced the antioxidant capacity of these cells, which resulted in lower ROS levels and prevention of ECM degradation. Given that oxidative stress is a key driver of IDD, APM is a promising agent for delaying or preventing IDD progression. In addition, APM treated cells had a significantly lower level of expression of matrix-degrading enzymes, such as MMP3, MMP13, ADAMTS-4, and ADAMTS-5, compared with the control, and these enzymes contribute to ECM breakdown in IDD. This low level of expression of catabolic enzymes is consistent with APM’s anti-inflammatory actions through the modulation of key signaling pathways. The protective effect of APM preserves ECM integrity, which is crucial for maintaining the structural and functional properties of the intervertebral disc. In addition to its effects on NP cells, APM has been shown to promote axonal regeneration and neurite outgrowth in neuronal injury models [14]. This is particularly important for understanding its broader therapeutic applications. This study has reported that APM enhances F-actin content in the growth cones of regenerating axons, improving neurite extension and axonal growth. Furthermore, APM upregulates the expression of regeneration-associated genes, such as NF200 and GAP43, as well as neurotrophic factors, such as BDNF and NGF. Although this current study focused on NP cells, these regenerative properties further support the potential of APM in treating degenerative conditions involving oxidative stress and cellular damage.
However, this study has some limitations that must be acknowledged. Firstly, this study was performed in vitro using NP cells, which does not represent the complexity of the in vivo environment of the intervertebral disc. Future investigations into the effects of APM in animal models of disc degeneration are needed to determine its therapeutic efficacy. In addition, although the level of expression of Nrf2 and HO-1 was significantly higher in the APM treated group, as compared with the control NP cells, the precise molecular mechanisms by which APM activates these pathways requires exploration. Finally, while no adverse effects were observed at the concentrations tested in vitro in this study, higher doses may cause toxicity, and the optimal therapeutic dose of APM for animal experiments needs to be determined.
APM offers promising protective effects for NP cells by enhancing antioxidant defenses, preserving ECM integrity, and inhibiting matrix-degrading enzymes. These protective mechanisms, along with APM’s neuroprotective and regenerative properties, position it as a potential therapeutic agent for treating IDD and other oxidative stress-related conditions. These preliminary findings need to be validated in vivo in animal models, and in clinical trials, and the broader therapeutic potential of APM in degenerative diseases should be explored.

Author Contributions

Conceptualization: HK and HB. Methodology: HK. Validation: HK. Formal analysis: HK. Investigation: HK and HSC. Data curation: HK and HSC. Writing - original draft: HK. Writing - review & editing: HSC and HB. Visualization: HK. Supervision: HB. Project administration: HB

Conflicts of Interest

The authors declare no conflicts of interest.

Author Use of AI Tools Statement

Artificial intelligence tools were not involved in any part of the scientific research, including data interpretation or result formulation.

Ethical Statement

Not applicable

All relevant data are included in this manuscript.
Figure 1
Protective effect of APM in the viability of H2O2-treated NP cells. (A) NP cells (5 × 103/well in 96-well plates) were treated with various concentrations of APM for 24-hour, and cell viability was assessed by CCK-8 assay (n = 6). (B) Cells were pretreated with APM for 30 minutes, followed by H2O2 exposure and 24-hour incubation. Viability was measured using CCK-8 (5 × 103 cells/well, n = 6). (C) ROS levels were evaluated by DCFDA-FITC staining and flow cytometry after 24-hour co-treatment with APM and H2O2 (2 × 105 cells/well in 6-well plates, n = 4). (D) Quantification of DCFDA+ cells from flow cytometry analysis in each group.
Statistical significance was determined using one-way ANOVA with Tukey’s post hoc test.
####p < 0.0001 (compared with the blank group).
*p < 0.05 (compared with the control group).
**p < 0.01 (compared with the control group).
***p < 0.001 (compared with the control group).
****p < 0.0001 (compared with the control group).
ANOVA = analysis of variance; APM = apamin; CCK-8 = cell counting kit-8; DCFDA = 2′;7′-dichlorofluorescin diacetate; FITC = fluorescein isothiocyanate; H2O2 = hydrogen peroxide; NP = nucleus pulposus; ROS = reactive oxygen species.
pim-2025-06-004f1.jpg
Figure 2
Protective effect of APM on ECM components in H2O2-treated NP cells. (A,B) Representative confocal immunofluorescence images of aggrecan (ACAN) and collagen type 2 alpha 1 (Col2a1) expression in NP cells after 24-hour treatment. Yellow scale bar = 200 μm; white scale bar = 50 μm. (C,D) Quantification of fluorescence intensity for each marker (2 × 104 cells/well in 24-well plates, n = 6).
Statistical significance was determined using one-way ANOVA with Tukey’s post hoc test.
####p < 0.0001 (compared with the blank group).
****p < 0.0001 (compared with the control group).
ANOVA = analysis of variance; APM = apamin; ECM = extracellular matrix; NP = nucleus pulposus.
pim-2025-06-004f2.jpg
Figure 3
Protective effect of APM on the expression of degenerative enzyme expression in H2O2-treated NP cells. (A–D) Representative confocal immunofluorescence images showing the expression of MMP3, MMP13, ADAMTS-4, and ADAMTS-5 in NP cells after 24-hour treatment with APM and H2O2. Yellow scale bar = 200 μm; white scale bar = 50 μm. (E–H) Quantification of fluorescence intensity for each marker (2 × 104 cells/well in 24-well plates, n = 6).
Statistical significance was determined using one-way ANOVA with Tukey’s post hoc test.
####p < 0.0001 (compared with the blank group).
*p < 0.05 (compared with the control group).
**p < 0.01 (compared with the control group).
***p < 0.001 (compared with the control group).
****p < 0.0001 (compared with the control group).
ADAMTS = a disintegrin and metalloproteinase with thrombospondin motifs; ANOVA = analysis of variance; APM = apamin; H2O2: hydrogen peroxide; MMP = matrix metalloproteinase.
pim-2025-06-004f3.jpg
Figure 4
Protective effect of APM on the expression of Nrf2 and HO-1 in H2O2-treated NP cells. (A) Representative confocal immunofluorescence images of Nrf2 and HO-1 expression in NP cells after 24-hour treatment with APM and H2O2. Yellow scale bar = 200 μm; white scale bar = 50 μm. (B, C) Quantification of fluorescence intensity for each marker (2 × 104 cells/well in 24-well plates, n = 6). (D, E) mRNA expression levels of Nrf2 and HO-1 analyzed by quantitative real-time PCR (2 × 105 cells/well in 6-well plates, n = 5).
Statistical significance was determined using one-way ANOVA with Tukey’s post hoc test.
#p < 0.05 (compared with the blank group).
##p < 0.01 (compared with the blank group).
###p < 0.001 (compared with the blank group).
*p < 0.05 (compared with the control group).
**p < 0.01 (compared with the control group).
****p < 0.0001 (compared with the control group).
ANOVA = analysis of variance; APM = apamin; H2O2 = hydrogen peroxide; HO-1 = heme oxygenase-1; mRNA = messenger ribonucleic acid; Nrf2 = Nuclear factor erythroid-2-related factor 2; PCR = polymerase chain reaction.
pim-2025-06-004f4.jpg
pim-2025-06-004f5.jpg
Table 1
Primer Sequences Used for Real-Time Polymerase Chain Reaction Analysis
Gene 5′-3′ Primer sequence
Nrf2 Forward GCTATGGAGACACACTACTTGG
Reverse CCAGGACTTACAGGCAATTCT

HO-1 Forward GGTCCTTACACTCAGCTTTCT
Reverse CATAGGCTCCTTCCTCCTTTC

GAPDH Forward AATGACCCCTTCATTGAC
Reverse TCCACGACGTACTCAGCGC
  • [1] Katz JN. Lumbar disc disorders and low-back pain: socioeconomic factors and consequences 2006;88 Suppl 2:21−4.ArticlePubMed
  • [2] Oichi T, Taniguchi Y, Oshima Y, Tanaka S, Saito T. Pathomechanism of intervertebral disc degeneration. JOR Spine 2020;3(1):e1076.. ArticlePubMedPMCPDF
  • [3] Bron JL, Koenderink GH, Everts V, Smit TH. Rheological characterization of the nucleus pulposus and dense collagen scaffolds intended for functional replacement. J Orthop Res 2009;27(5):620−6.ArticlePubMed
  • [4] Dou Y, Sun X, Ma X, Zhao X, Yang Q. Intervertebral disk degeneration: the microenvironment and tissue engineering strategies. Front Bioeng Biotechnol 2021;9:592118. ArticlePubMedPMC
  • [5] Zhang GZ, Liu MQ, Chen HW, Wu ZL, Gao YC, Ma ZJ, et al. NF-κB signalling pathways in nucleus pulposus cell function and intervertebral disc degeneration. Cell Prolif 2021;54(7):e13057.. ArticlePubMedPMCPDF
  • [6] Bahar ME, Hwang JS, Lai TH, Byun JH, Kim DH, Kim DR. The survival of human intervertebral disc nucleus pulposus cells under oxidative stress relies on the autophagy triggered by delphinidin. Antioxidants (Basel) 2024;13(7):759. ArticlePubMedPMC
  • [7] Feng C, Yang M, Lan M, Liu C, Zhang Y, Huang B, et al. ROS: crucial intermediators in the pathogenesis of intervertebral disc degeneration. Oxid Med Cell Longev 2017;2017:5601593. ArticlePubMedPMCPDF
  • [8] Li Y, Chen L, Gao Y, Zou X, Wei F. Oxidative stress and intervertebral disc degeneration: pathophysiology, signaling pathway, and therapy. Oxid Med Cell Longev 2022;2022:1984742. ArticlePubMedPMCPDF
  • [9] Rahman T, Tavana S, Baxan N, Raftery KA, Morgan G, Schaer TP, et al. Quantifying internal intervertebral disc strains to assess nucleus replacement device designs: a digital volume correlation and ultra-high-resolution MRI study. Front Bioeng Biotechnol 2023;11:1229388. ArticlePubMedPMC
  • [10] Szentléleky E, Szegeczki V, Karanyicz E, Hajdú T, Tamás A, Tóth G, et al. Pituitary adenylate cyclase activating polypeptide (PACAP) reduces oxidative and mechanical stress-evoked matrix degradation in chondrifying cell cultures. Int J Mol Sci 2019;20(1):168. ArticlePubMedPMC
  • [11] Zheng X, Qiu J, Ye J, Gong Y, Jiang T, Gao N, et al. Macrophage-derived PDGF-BB modulates glycolytic enzymes expression and pyroptosis in nucleus pulposus cells via PDGFR-β/TXNIP pathway. Osteoarthritis Cartilage 2024;32(10):1245−60.ArticlePubMed
  • [12] Liu Q, Tan Z, Xie C, Ling L, Hu H. Oxidative stress as a critical factor might involve in intervertebral disc degeneration via regulating NOXs/FOXOs. J Orthop Sci 2023;28(1):105−11.ArticlePubMed
  • [13] Gu H, Han SM, Park KK. Therapeutic effects of apamin as a bee venom component for non-neoplastic disease. Toxins (Basel) 2020;12(3):195. ArticlePubMedPMC
  • [14] Kim H, Hong JY, Lee J, Jeon W-J, Ha IH. Apamin enhances neurite outgrowth and regeneration after laceration injury in cortical neurons. Toxins (Basel) 2021;13(9):603. ArticlePubMedPMC
  • [15] Kim J-Y, Leem J, Park KK. Antioxidative, antiapoptotic, and anti-inflammatory effects of apamin in a murine model of lipopolysaccharide-induced acute kidney injury. Molecules 2020;25(23):5717. ArticlePubMedPMC
  • [16] Park J, Jang KM, Park KK. Effects of apamin on MPP(+)-induced calcium overload and neurotoxicity by targeting CaMKII/ERK/p65/STAT3 signaling pathways in dopaminergic neuronal cells. Int J Mol Sci 2022;23(23):15255. ArticlePubMedPMC
  • [17] Jang HJ, Leem J, Kim GM. Protective effects of apamin on acetaminophen-induced hepatotoxicity in mice. Curr Issues Mol Biol 2023;45(5):4389−99.ArticlePubMedPMC
  • [18] Ahmed SMU, Luo L, Namani A, Wang XJ, Tang X. Nrf2 signaling pathway: pivotal roles in inflammation. Biochim Biophys Acta Mol Basis Dis 2017;1863(2):585−97.ArticlePubMed
  • [19] Loboda A, Damulewicz M, Pyza E, Jozkowicz A, Dulak J. Role of Nrf2/HO-1 system in development, oxidative stress response and diseases: an evolutionarily conserved mechanism. Cell Mol Life Sci 2016;73(17):3221−47.ArticlePubMedPMCPDF
  • [20] Slebos D-J, Ryter SW, Choi AMK. Heme oxygenase-1 and carbon monoxide in pulmonary medicine. Respir Res 2003;4:7. ArticlePubMedPMCPDF
  • [21] Vijayan V, Wagener FADTG, Immenschuh S. The macrophage hemeheme oxygenase-1 system and its role in inflammation. Biochem Pharmacol 2018;153:159−67.ArticlePubMed
  • [22] Yang X, Fang Y, Hou J, Wang X, Li J, Li S, et al. The heart as a target for deltamethrin toxicity: Inhibition of Nrf2/HO-1 pathway induces oxidative stress and results in inflammation and apoptosis. Chemosphere 2022;300:134479. ArticlePubMed
  • [23] Zhang Q, Liu J, Duan H, Li R, Peng W, Wu C. Activation of Nrf2/HO-1 signaling: an important molecular mechanism of herbal medicine in the treatment of atherosclerosis via the protection of vascular endothelial cells from oxidative stress. J Adv Res 2021;34:43−63.ArticlePubMedPMC

Figure & Data

References

    Citations

    Citations to this article as recorded by  
    • Pullulan-based polymeric nanosystem for KEAP1 siRNA delivery: Mitigating ROS and promoting wound healing in vitro
      Gülşen Bayrak, Dilara Karaguzel, Cagatay Karaaslan, Işık Perçin
      Colloids and Surfaces B: Biointerfaces.2026; 260: 115352.     CrossRef

    • PubReader PubReader
    • ePub LinkePub Link
    • Cite
      Download Citation
      Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

      Format:
      • RIS — For EndNote, ProCite, RefWorks, and most other reference management software
      • BibTeX — For JabRef, BibDesk, and other BibTeX-specific software
      Include:
      • Citation for the content below
      Apamin Mitigates Oxidative Stress-Induced Nucleus Pulposus Cell Death Through Regulation of Nrf2 and HO-1 Pathways
      Perspect Integr Med. 2025;4(2):96-102.   Published online June 23, 2025
      Close
    • XML DownloadXML Download
    Figure
    • 0
    • 1
    • 2
    • 3
    • 4
    Apamin Mitigates Oxidative Stress-Induced Nucleus Pulposus Cell Death Through Regulation of Nrf2 and HO-1 Pathways
    Image Image Image Image Image
    Figure 1 Protective effect of APM in the viability of H2O2-treated NP cells. (A) NP cells (5 × 103/well in 96-well plates) were treated with various concentrations of APM for 24-hour, and cell viability was assessed by CCK-8 assay (n = 6). (B) Cells were pretreated with APM for 30 minutes, followed by H2O2 exposure and 24-hour incubation. Viability was measured using CCK-8 (5 × 103 cells/well, n = 6). (C) ROS levels were evaluated by DCFDA-FITC staining and flow cytometry after 24-hour co-treatment with APM and H2O2 (2 × 105 cells/well in 6-well plates, n = 4). (D) Quantification of DCFDA+ cells from flow cytometry analysis in each group. Statistical significance was determined using one-way ANOVA with Tukey’s post hoc test. ####p < 0.0001 (compared with the blank group). *p < 0.05 (compared with the control group). **p < 0.01 (compared with the control group). ***p < 0.001 (compared with the control group). ****p < 0.0001 (compared with the control group). ANOVA = analysis of variance; APM = apamin; CCK-8 = cell counting kit-8; DCFDA = 2′;7′-dichlorofluorescin diacetate; FITC = fluorescein isothiocyanate; H2O2 = hydrogen peroxide; NP = nucleus pulposus; ROS = reactive oxygen species.
    Figure 2 Protective effect of APM on ECM components in H2O2-treated NP cells. (A,B) Representative confocal immunofluorescence images of aggrecan (ACAN) and collagen type 2 alpha 1 (Col2a1) expression in NP cells after 24-hour treatment. Yellow scale bar = 200 μm; white scale bar = 50 μm. (C,D) Quantification of fluorescence intensity for each marker (2 × 104 cells/well in 24-well plates, n = 6). Statistical significance was determined using one-way ANOVA with Tukey’s post hoc test. ####p < 0.0001 (compared with the blank group). ****p < 0.0001 (compared with the control group). ANOVA = analysis of variance; APM = apamin; ECM = extracellular matrix; NP = nucleus pulposus.
    Figure 3 Protective effect of APM on the expression of degenerative enzyme expression in H2O2-treated NP cells. (A–D) Representative confocal immunofluorescence images showing the expression of MMP3, MMP13, ADAMTS-4, and ADAMTS-5 in NP cells after 24-hour treatment with APM and H2O2. Yellow scale bar = 200 μm; white scale bar = 50 μm. (E–H) Quantification of fluorescence intensity for each marker (2 × 104 cells/well in 24-well plates, n = 6). Statistical significance was determined using one-way ANOVA with Tukey’s post hoc test. ####p < 0.0001 (compared with the blank group). *p < 0.05 (compared with the control group). **p < 0.01 (compared with the control group). ***p < 0.001 (compared with the control group). ****p < 0.0001 (compared with the control group). ADAMTS = a disintegrin and metalloproteinase with thrombospondin motifs; ANOVA = analysis of variance; APM = apamin; H2O2: hydrogen peroxide; MMP = matrix metalloproteinase.
    Figure 4 Protective effect of APM on the expression of Nrf2 and HO-1 in H2O2-treated NP cells. (A) Representative confocal immunofluorescence images of Nrf2 and HO-1 expression in NP cells after 24-hour treatment with APM and H2O2. Yellow scale bar = 200 μm; white scale bar = 50 μm. (B, C) Quantification of fluorescence intensity for each marker (2 × 104 cells/well in 24-well plates, n = 6). (D, E) mRNA expression levels of Nrf2 and HO-1 analyzed by quantitative real-time PCR (2 × 105 cells/well in 6-well plates, n = 5). Statistical significance was determined using one-way ANOVA with Tukey’s post hoc test. #p < 0.05 (compared with the blank group). ##p < 0.01 (compared with the blank group). ###p < 0.001 (compared with the blank group). *p < 0.05 (compared with the control group). **p < 0.01 (compared with the control group). ****p < 0.0001 (compared with the control group). ANOVA = analysis of variance; APM = apamin; H2O2 = hydrogen peroxide; HO-1 = heme oxygenase-1; mRNA = messenger ribonucleic acid; Nrf2 = Nuclear factor erythroid-2-related factor 2; PCR = polymerase chain reaction.
    Graphical abstract
    Apamin Mitigates Oxidative Stress-Induced Nucleus Pulposus Cell Death Through Regulation of Nrf2 and HO-1 Pathways
    Gene 5′-3′ Primer sequence
    Nrf2 Forward GCTATGGAGACACACTACTTGG
    Reverse CCAGGACTTACAGGCAATTCT

    HO-1 Forward GGTCCTTACACTCAGCTTTCT
    Reverse CATAGGCTCCTTCCTCCTTTC

    GAPDH Forward AATGACCCCTTCATTGAC
    Reverse TCCACGACGTACTCAGCGC
    Table 1 Primer Sequences Used for Real-Time Polymerase Chain Reaction Analysis


    Perspect Integr Med : Perspectives on Integrative Medicine
    TOP